IthaID: 3261



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs9736333 HGVS Name: NG_000007.3:g.16784A>G

Context nucleotide sequence:
GTTACACAGAACCAGAAGGCGGGGG [ C/T] GGGGCACTGACCCCGACAGGGGCCT (Strand: +)

Also known as:

Comments: SNP is located in DNase I HS-2 within a putative ZBTB7A-binding site. ZBTB7A (leukemia/lymphoma related factor; LRF) is an important repressor of γ-globin gene transcription. SNP was reported to influence HbF levels in patients with African origin haplotypes of sickle cell anaemia (study samples were obtained from the Cooperative Study of Sickle Cell Disease (CSSCD)).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 16784
Size: 1 bp
Located at: βLCR
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Shaikho EM, Habara AH, Alsultan A, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Alsuliman A, Qutub HO, Patra PK, Sebastiani P, Baltrusaitis K, Farrell JJ, Jiang Z, Luo HY, Chui DH, Al-Ali AK, Steinberg MH, Variants of ZBTB7A (LRF) and its β-globin gene cluster binding motifs in sickle cell anemia., Blood Cells Mol. Dis. , 59(0), 49-51, 2016 PubMed
  2. Habara AH, Shaikho EM, Steinberg MH, Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents., Am. J. Hematol. , 2017 PubMed
Created on 2017-09-22 19:25:43, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.