IthaID: 3259



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs2333227 HGVS Name: NG_009629.1:g.4535G>A

Context nucleotide sequence:
AGCACTTTGGGAGGCTGAGGC [G>A] GGTGGATCACTTGAGGTCAGG (Strand: -)

Also known as: -463G>A

Comments: Association with increased susceptibility to infections in sickle cell anaemia (SCA). Association with lipid (i.e. total cholesterol and low-density lipoprotein cholesterol (LDL-C)) laboratory markers in SCA patients treated with hydroxyurea. Association with hepatic (i.e. globulin), inflammation (i.e. uric acid) and lipid/glycemic (i.e. glucose) laboratory markers in SCA patients not treated with hydroxyurea.

External Links

Location

Chromosome: 17
Locus: NG_009629.1
Locus Location: 4535
Size: 1 bp
Located at: MPO
Specific Location: Promoter

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Recurrent infections [HP:0002719]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Brazilian
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Costa RN, Conran N, Albuquerque DM, Soares PH, Saad ST, Costa FF, Association of the G-463A myeloperoxidase polymorphism with infection in sickle cell anemia., Haematologica , 90(7), 977-9, 2005 PubMed
  2. Yahouédéhou SCMA, Carvalho MOS, Oliveira RM, Santiago RP, da Guarda CC, Carvalho SP, Ferreira JRD, Aleluia MM, Adorno EV, Gonçalves MS, Sickle Cell Anemia Patients in Use of Hydroxyurea: Association between Polymorphisms in Genes Encoding Metabolizing Drug Enzymes and Laboratory Parameters., Dis. Markers, 2018(0), 6105691, 2018 PubMed
Created on 2017-09-21 19:26:32, Last reviewed on 2020-09-16 16:56:31 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.