IthaID: 3254
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs5742909 | HGVS Name: | NG_011502.1:g.4839C>T |
Context nucleotide sequence:
GTCTCCACTTAGTTATCCAGATCCT [C/T] AAAGTGAACATGAAGCTTCAGTTTC (Strand: +)
Also known as: -318 C/T
Comments: SNP (T allele) associated with a higher risk of post-transfusion alloantibody development in sickle cell disease patients from Brazil.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Red blood cell alloimmunisation |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_011502.1 |
Locus Location: | 4839 |
Size: | 1 bp |
Located at: | CTLA4 |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Oliveira VB, Dezan MR, Gomes FCA, Menosi Gualandro SF, Krieger JE, Pereira AC, Marsiglia JD, Levi JE, Rocha V, Mendrone-Junior A, Sabino EC, Dinardo CL, -318C/T polymorphism of the CTLA-4 gene is an independent risk factor for RBC alloimmunization among sickle cell disease patients., Int. J. Immunogenet. , 2017 PubMed
Created on 2017-09-06 18:23:04,
Last reviewed on (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-09-06 18:23:04 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-05-24 15:38:45