IthaID: 3249



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 135 GCT>GC- HGVS Name: HBB:c.408delT
Hb Name: Hb Urumqi Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGCTGCCTATCAGAAAGTGGTGGC [-/T] ACCCGGTCCCGTAATCGGTGTGG (Strand: -)

Comments: Discovered by capture-based NGS of 22260 samples (South China origin) as a de novo mutation with an HbF-related SNP (rs368698783). Reported in a Chinese girl with splenomegaly, jaundice and macrocytic, haemolytic anaemia. The deletion results in a frameshift in the β-globin sequence, thus extending the read to the next TAA stop signal located at position 158. This leads to a completely different C-terminal amino acid sequence and presumed synthesis of an abnormal β-globin chain that is 157 residues long. cDNA sequencing from total RNA revealed that mutant β-globin chain was transcribed into mRNA at a relatively low quantity. However, no abnormal Hb was detected by CE and HPLC, possibly because abnormal β-globin chains precipitate early in the erythroid precursors. Normal isopropanol stability test.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71982
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Pu J, Zhang L, Wei X, Xu X, Clinical Genotyping by Next Generation Sequencing Reveals a Novel, De Novo β-Globin Gene Mutation Causing Hemolytic Anemia in a Chinese Individual., Hemoglobin, 42(3), 184-188, 2018 PubMed
Created on 2017-08-21 12:55:48, Last reviewed on 2019-11-22 08:48:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.