IthaID: 3249
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 135 GCT>GC- | HGVS Name: | HBB:c.408delT |
| Hb Name: | Hb Urumqi | Protein Info: | N/A |
Context nucleotide sequence:
GGCTGCCTATCAGAAAGTGGTGGC [-/T] ACCCGGTCCCGTAATCGGTGTGG (Strand: -)
Also known as:
Comments: Discovered by capture-based NGS of 22260 samples (South China origin) as a de novo mutation with an HbF-related SNP (rs368698783). Reported in a Chinese girl with splenomegaly, jaundice and macrocytic, haemolytic anaemia. The deletion results in a frameshift in the β-globin sequence, thus extending the read to the next TAA stop signal located at position 158. This leads to a completely different C-terminal amino acid sequence and presumed synthesis of an abnormal β-globin chain that is 157 residues long. cDNA sequencing from total RNA revealed that mutant β-globin chain was transcribed into mRNA at a relatively low quantity. However, no abnormal Hb was detected by CE and HPLC, possibly because abnormal β-globin chains precipitate early in the erythroid precursors. Normal isopropanol stability test.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Hyperunstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71982 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Pu J, Zhang L, Wei X, Xu X, Clinical Genotyping by Next Generation Sequencing Reveals a Novel, De Novo β-Globin Gene Mutation Causing Hemolytic Anemia in a Chinese Individual., Hemoglobin, 42(3), 184-188, 2018 PubMed
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2017-08-21 12:55:48 | The IthaGenes Curation Team | Created |
| 2 | 2017-08-22 09:20:19 | The IthaGenes Curation Team | Reviewed. Name updated. |
| 3 | 2019-04-09 12:27:10 | The IthaGenes Curation Team | Reviewed. DNA info (allele, strand, context sequence), Comment, Protein info, Clinical phenotype, Inheritance and Reference added. |
| 4 | 2019-06-24 15:45:45 | The IthaGenes Curation Team | Reviewed. HbVar link and Allele phenotype added. Comment updated. |
| 5 | 2019-11-22 08:48:53 | The IthaGenes Curation Team | Reviewed. Text edits. |