IthaID: 3249



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 135 GCT>GC- HGVS Name: HBB:c.408delT
Hb Name: Hb Urumqi Protein Info: N/A

Context nucleotide sequence:
GGCTGCCTATCAGAAAGTGGTGGC [T/-] ACCCGGTCCCGTAATCGGTGTGG (Strand: -)

Comments: Discovered by capture-based NGS of 22260 samples (South China origin) as a de novo mutation with an HbF-related SNP (rs368698783). The deletion results in a frameshift in the β-globin sequence, thus extending the read to the next TAA stop signal located at position 158. This leads to a completely different C-terminal amino acid sequence and presumed synthesis of an abnormal β-globin chain that is 157 residues long instead of the normal 147.

External Links

No available links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71982
Size: 1 bp
Located at: β
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Pu J, Zhang L, Wei X, Xu X, Clinical Genotyping by Next Generation Sequencing Reveals a Novel, De Novo β-Globin Gene Mutation Causing Hemolytic Anemia in a Chinese Individual., Hemoglobin, 42(3), 184-188, 2018 PubMed

Microattributions

A/AContributor(s)DateComments
1Xu, Xiangmin2017-08-09First report.
Created on 2017-08-21 12:55:48, Last reviewed on 2019-04-09 12:27:10 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.