IthaID: 3245
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs4696480 | HGVS Name: | NG_016229.1:g.6686T>A |
Context nucleotide sequence:
TCCAAGATTGAAGGGCTGCATCTGG [A/T] GAGGGTCATCTGGCTACATTATAAC (Strand: +)
Also known as:
Comments: SNP associated with occurrence of infections in patients with sickle cell disease. The TA genotype associated with susceptibility to bacterial infections in a paediatric cohort [PMID: 28667380], but was protective against infections in an adult cohort [PMID: 30908604].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Recurrent respiratory infections [HP:002205] |
Location
| Chromosome: | 4 |
|---|---|
| Locus: | NG_016229.1 |
| Locus Location: | 6686 |
| Size: | 1 bp |
| Located at: | TLR2 |
| Specific Location: | Promoter 0 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Brazilian, Sub-Saharan African, French West Indies, North African, Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- David S, Aguiar P, Antunes L, Dias A, Morais A, Sakuntabhai A, Lavinha J, Variants in the non-coding region of the TLR2 gene associated with infectious subphenotypes in pediatric sickle cell anemia., Immunogenetics , 2017 PubMed
- Tozatto-Maio K, Girot R, Ly ID, Rocha V, Silva Pinto AC, Diagne I, Benzerara Y, Dinardo CL, Kashima S, Leston-Araujo I, Kenzey C, Fonseca GHH, Rodrigues ES, Volt F, Jarduli LR, Ruggeri A, Mariaselvam CM, Gualandro SFM, Elayoubi H, Cunha R, Cappelli B, Malmegrim KCR, Simões BP, Gluckman E, Tamouza R, A Toll-like receptor 2 genetic variant modulates occurrence of bacterial infections in patients with sickle cell disease., Br. J. Haematol., 2019 PubMed
Created on 2017-07-24 14:08:45,
Last reviewed on 2019-12-23 15:10:20 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2017-07-24 14:08:45 | The IthaGenes Curation Team | Created |
| 2 | 2019-05-17 14:14:41 | The IthaGenes Curation Team | Reviewed. Mutation comment updated. Ethnic origin and Reference added. |
| 3 | 2019-05-17 14:15:22 | The IthaGenes Curation Team | Reviewed. |
| 4 | 2019-07-03 22:21:01 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
| 5 | 2019-12-23 15:10:20 | The IthaGenes Curation Team | Reviewed. Phenotype corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-03 11:48:06