IthaID: 3245



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4696480 HGVS Name: NG_016229.1:g.6686T>A

Context nucleotide sequence:
TCCAAGATTGAAGGGCTGCATCTGG [A/T] GAGGGTCATCTGGCTACATTATAAC (Strand: +)

Also known as:

Comments: SNP associated with occurrence of infections in patients with sickle cell disease. The TA genotype associated with susceptibility to bacterial infections in a paediatric cohort [PMID: 28667380], but was protective against infections in an adult cohort [PMID: 30908604].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Recurrent respiratory infections [HP:002205]

Location

Chromosome: 4
Locus: NG_016229.1
Locus Location: 6686
Size: 1 bp
Located at: TLR2
Specific Location: Promoter 0

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Brazilian, Sub-Saharan African, French West Indies, North African, Indian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. David S, Aguiar P, Antunes L, Dias A, Morais A, Sakuntabhai A, Lavinha J, Variants in the non-coding region of the TLR2 gene associated with infectious subphenotypes in pediatric sickle cell anemia., Immunogenetics , 2017 PubMed
  2. Tozatto-Maio K, Girot R, Ly ID, Rocha V, Silva Pinto AC, Diagne I, Benzerara Y, Dinardo CL, Kashima S, Leston-Araujo I, Kenzey C, Fonseca GHH, Rodrigues ES, Volt F, Jarduli LR, Ruggeri A, Mariaselvam CM, Gualandro SFM, Elayoubi H, Cunha R, Cappelli B, Malmegrim KCR, Simões BP, Gluckman E, Tamouza R, A Toll-like receptor 2 genetic variant modulates occurrence of bacterial infections in patients with sickle cell disease., Br. J. Haematol., 2019 PubMed
Created on 2017-07-24 14:08:45, Last reviewed on 2019-12-23 15:10:20 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.