IthaID: 3231

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	N/A
Common Name:	CD 7 (-3bp): (-GAG)	HGVS Name:	HBD:c.22_24delGAG
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
TGGTGCATCTGACTCCTGAG [GAG/-] AAGACTGCTGTCAATGCCCT (Strand: +)

Also known as:

Comments: Found in one case after haematological and mutation spectrum analysis of δ-globin gene in Chinese Han prenatal population [PMID: 28592066]. One additional case reported in a 41-year-old Chinese male presented with normal haematological indices, Hb 16.3 g/dL, RBC 4.88×1012/L, MCV 97.3 fL, MCH 33.4 pg, MCHC 34.3 g/L. Capillary electrophoresis shown normal levels of HbA 98.4%, HbA2 1.3% and HbF 0.3%.

External Links

No available links

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	δ-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	63204
Size:	3 bp
Located at:	δ
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Insertion/Deletion of codons (Protein Structure)
Ethnic Origin:	Chinese Han
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Zhong LY, Xie YJ, Chen PS, Feng YW, Liu M, Huang B, He XH, Gan X, [Analysis of haematological phenotype and mutation spectrum of δ-globin gene from Guangdong area in Chinese Han prenatal population]., Zhonghua Yi Xue Za Zhi , 97(20), 1580-1583, 2017 PubMed

Microattributions

A/A	Contributor(s)	Date	Comments
1	Li, Youqiong	2021-04-12	Report of an update.

Created on 2017-07-11 15:48:01, Last reviewed on 2021-04-22 11:19:06 (Show full history)

A/A	Date	Curator(s)	Comments
1	2017-07-11 15:48:01	The IthaGenes Curation Team	Created
2	2021-04-22 11:19:06	The IthaGenes Curation Team	Reviewed. Comment and contributor added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.