IthaID: 3225



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 78/85 (-20bp) HGVS Name: HBB:c.237_256delGGACAACCTCAAGGGCACCT
Hb Name: N/A Protein Info: N/A

Comments: The deletion spans from the third base of codon 78 to the first base of codon 85, resulting in a frameshift and a stop codon in position 83. The deleted sequence is flanked by CACCT sequences that could have been misaligned during replication and therefore originated this deletion.

External Links

No available links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70961
Size: 20 bp
Located at: β
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Mexican
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ, Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients., Int J Lab Hematol , 2017 PubMed
Created on 2017-07-11 10:47:08, Last reviewed on 2017-07-11 13:22:57 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.