IthaID: 3224

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -90 (C>G) HGVS Name: HBB:c.-140C>G
Hb Name: N/A Protein Info: N/A

Also known as:

Comments: The -90 C>G mutation is a change in the 90th nucleotide upstream the transcription initiation site. Its putative pathological effect is a decreased binding rate of KLF1, thereby reducing the expression of the HBB gene.

External Links


Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]


Chromosome: 11
Locus: NG_000007.3
Locus Location: 70455
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Mexican
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.


Publications / Origin

  1. Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ, Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients., Int J Lab Hematol , 2017 PubMed
Created on 2017-07-11 10:14:24, Last reviewed on 2017-07-11 10:17:41 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.