IthaID: 3211
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs12094024 | HGVS Name: | NG_007939.1:g.21183A>C |
Context nucleotide sequence:
ACCAGTGGTATCTCCTGGTTTCTCT [A/C] CTGCATRGCCCTGTACCCTGAGCAC (Strand: +)
Protein sequence:
MVPSFLSLSFSSLGLWASGLILVLGFLKLIHLLLRRQTLAKAMDKFPGPPTHWLFGHALEIQETGSLDKVVSWAHQFPYAHPLWFGQFIGFLNIYEPDYAKAVYSRGDPKAPDVYDFFLQWIGRGLLVLEGPKWLQHRKLLTPGFHYDVLKPYVAVFTESTRIMLDKWEEKAREGKSFDIFCDVGHMALNTLMKCTFGRGDTGLGHRDSSYYLAVSDLTLLMQQRLVSFQYHNDFIYWLTPHGRRFLRACQVAHDHTDQVIRERKAALQDEKVRKKIQNRRHLDFLDILLGARDEDDIKLSDADLRAEVDTFMFEGHDTTTSGISWFLSCMALYPEHQHRCREEVREILGDQDFFQWDDLGKMTYLTMCIKESFRLYPPVPQVYRQLSKPVTFVDGRSLPAGSLISMHIYALHRNSAVWPDPEVFDSLRFSTENASKRHPFAFMPFSAGPRNCIGQQFAMSEMKVVTAMCLLRFEFSLDPSRLPIKMPQLVLRSKNGFHLHLKPLGPGSGK
Also known as:
Comments: SNP associated with increased glomerular filtration rate in SCA pediatric patients enrolled from the TWiTCH (TCD With Transfusions Changing to Hydroxyurea) trial.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Abnormal GFR [HP:0012212] |
Location
Chromosome: | 1 |
---|---|
Locus: | NG_007939.1 |
Locus Location: | 21183 |
Size: | 1 bp |
Located at: | CYP4B1 |
Specific Location: | Exon 8 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-03-21 14:52:30 | The IthaGenes Curation Team | Created |
2 | 2017-03-21 14:54:45 | The IthaGenes Curation Team | Reviewed. DNA info updated. |