IthaID: 3205

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs2814778	HGVS Name:	NG_011626.2:g.5174T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGCTGTCAGCGCCTGTGCTTCCAAG [A/G] TAAGAGCCAAGGACTAATGAGGGCC (Strand: -)

Comments: SNP associated with white blood cell (WBC) and absolute neutrophil count (ANC) levels in SCA pediatric cohorts acquired from the HUSTLE (Hydroxyurea Study of Long-termEffects), SWiTCH (StrokeWith Transfusions Changing to Hydroxyurea) and TWiTCH (TCDWith Transfusions Changing to Hydroxyurea) clinical trials. It also associated with a small protective effect against albuminuria in participants from the HUSTLE and TWiTCH studies.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Abnormal neutrophil cell number [HP:0011991] Abnormal white blood cell count [HP:0011893] Albuminuria [HP:0012592]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	1
Locus:	NG_011626.1
Locus Location:	5174
Size:	1 bp
Located at:	ACKR1
Specific Location:	5'UTR

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	5'UTR (Transcription)
Ethnic Origin:	N/A
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016 PubMed

Created on 2017-03-13 15:08:12, Last reviewed on 2017-03-13 16:21:59 (Show full history)

A/A	Date	Curator(s)	Comments
1	2017-03-13 15:08:12	The IthaGenes Curation Team	Created
2	2017-03-13 15:09:36	The IthaGenes Curation Team	Reviewed.
3	2017-03-13 16:21:59	The IthaGenes Curation Team	Reviewed. Clinical phenotype section updated.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.