IthaID: 3197



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs10877969 HGVS Name: NC_000012.12:g.63153459T>C

Context nucleotide sequence:
TTGTAGAACCAGTCCCTTTGTTTAA [T/C] CCATATAGTTTTAAACATGTTTTTG (Strand: +)

Also known as:

Comments: SNV associated with acute pain in African Americans with sickle cell disease (n=107). The CT genotype associated with more frequent acute SCD pain utilization events. Individuals with the CC genotype were less likely to report stress as a pain aggravator.

External Links

Location

Chromosome: 12
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: AVPR1A
Specific Location: Intron

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Inheritance: Quantitative trait
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Roach K, Jhun E, He Y, Suarez M, Yao Y, Molokie R, Wang Z, Wilkie D, (245) Vasopressin SNP is related to sickle cell acute care utilization for pain., J Pain , 17(4), S36, 2016 PubMed
  2. Powell-Roach KL, Yao Y, Jhun EH, He Y, Suarez ML, Ezenwa MO, Molokie RE, Wang ZJ, Wilkie DJ, Vasopressin SNP pain factors and stress in sickle cell disease., PLoS ONE, 14(11), e0224886, 2019 PubMed
Created on 2017-02-28 12:02:34, Last reviewed on 2020-05-19 10:46:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.