IthaID: 3197
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs10877969 | HGVS Name: | NC_000012.12:g.63153459T>C |
Context nucleotide sequence:
TTGTAGAACCAGTCCCTTTGTTTAA [T/C] CCATATAGTTTTAAACATGTTTTTG (Strand: +)
Also known as:
Comments: SNV associated with acute pain in African Americans with sickle cell disease (n=107). The CT genotype associated with more frequent acute SCD pain utilization events. Individuals with the CC genotype were less likely to report stress as a pain aggravator.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Pain [HP:0012531] |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Roach K, Jhun E, He Y, Suarez M, Yao Y, Molokie R, Wang Z, Wilkie D, (245) Vasopressin SNP is related to sickle cell acute care utilization for pain., J Pain , 17(4), S36, 2016 PubMed
- Powell-Roach KL, Yao Y, Jhun EH, He Y, Suarez ML, Ezenwa MO, Molokie RE, Wang ZJ, Wilkie DJ, Vasopressin SNP pain factors and stress in sickle cell disease., PLoS ONE, 14(11), e0224886, 2019 PubMed
Created on 2017-02-28 12:02:34,
Last reviewed on 2020-05-19 10:46:46 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-02-28 12:02:34 | The IthaGenes Curation Team | Created |
2 | 2020-05-19 10:46:46 | The IthaGenes Curation Team | Reviewed. Reference added, Comment edited and Allele corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02