IthaID: 3196



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1478605 HGVS Name: NC_000015.10:g.39581083G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AACTCGCAGGCCAGCTCGGGCGCAG [C/T] GGCTGGCAAGGCGGAGGAGCCGCGC (Strand: -)

Comments: SNP associated with variation in pulmonary artery systolic pressure in individuals with sickle cell disease from the multicenter walk-PHaSST trial (Treatment of Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pulmonary arterial hypertension [HP:0002092] [OMIM:265400]

Location

Chromosome: 15
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: THBS1
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Jacob SA, Novelli EM, Isenberg JS, Garrett ME, Chu Y, Soldano K, Ataga KI, Telen MJ, Ashley-Koch A, Gladwin MT, Zhang Y, Kato GJ, Thrombospondin-1 gene polymorphism is associated with estimated pulmonary artery pressure in patients with sickle cell anemia., Am. J. Hematol. , 92(3), E31-E34, 2017 PubMed
Created on 2017-02-21 14:44:50, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.