IthaID: 3178



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2010963 HGVS Name: NG_008732.1:g.5398C>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CGCGCGGGCGTGCGAGCAGCGAAAG [C/G] GACAGGGGCAAAGTGAGTGACCTGC (Strand: +)

Comments: SNP associated with vaso-occlusive crisis in Bahraini with sickle cell anaemia.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Vaso-occlusive crisis

Location

Chromosome: 6
Locus: NG_008732.1
Locus Location: 5398
Size: 1 bp
Located at: VEGFA
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Bahraini
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Al-Habboubi HH, Mahdi N, Abu-Hijleh TM, Abu-Hijleh FM, Sater MS, Almawi WY, The relation of vascular endothelial growth factor (VEGF) gene polymorphisms on VEGF levels and the risk of vasoocclusive crisis in sickle cell disease., Eur. J. Haematol. , 89(5), 403-9, 2012 PubMed
Created on 2017-02-14 14:42:00, Last reviewed on 2017-02-14 14:43:27 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.