IthaID: 3176



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs9496646 HGVS Name: NG_027676.1:g.16974T>C

Context nucleotide sequence:
AGGAAAGGAGAGAAATGGGAAGATC [A/G] CTAGAAATGCAAGTGAAATTGAGTT (Strand: +)

Also known as:

Comments: SNP associated with E/e' (an established indicator for diastolic dysfunction) in African Americans with sickle cell disease, likely by affecting expression levels of its respective gene.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Left ventricular diastolic dysfunction [HP:0025168]

Location

Chromosome: 6
Locus: NG_027676.1
Locus Location: 16974
Size: 1 bp
Located at: FUCA2
Specific Location: Intron 5

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Duarte JD, Desai AA, Sysol JR, Abbasi T, Patel AR, Lang RM, Gupta A, Garcia JG, Gordeuk VR, Machado RF, Genome-Wide Analysis Identifies IL-18 and FUCA2 as Novel Genes Associated with Diastolic Function in African Americans with Sickle Cell Disease., PLoS ONE , 11(9), e0163013, 2016 PubMed
Created on 2017-02-14 11:27:43, Last reviewed on 2019-09-30 11:08:15 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.