IthaID: 3174
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7166737 | HGVS Name: | NC_000015.10:g.75390172A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGCTCCCCTGCTGAGAGAGGAACCT [A/G] CTCTCCCAGCCTGCACAAGAGCATT (Strand: +)
Comments: SNP associated with HbF response to treatment with hydroxyurea in β-thalassemia patients of Greek origin.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F response to hydroxyurea |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Gravia A, Chondrou V, Kolliopoulou A, Kourakli A, John A, Symeonidis A, Ali BR, Sgourou A, Papachatzopoulou A, Katsila T, Patrinos GP, Correlation of SIN3A genomic variants with β-hemoglobinopathies disease severity and hydroxyurea treatment efficacy., Pharmacogenomics , 2016 PubMed
Created on 2017-02-06 15:48:17,
Last reviewed on 2017-02-06 15:50:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.