IthaID: 3173



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs11072544 HGVS Name: NC_000015.10:g.75373740G>A

Context nucleotide sequence:
GCCCTGGGCAACGTAAGGAGACCCC [A/G] TGTCTATTTTCATTAAAAAAAAAAA (Strand: +)

Also known as:

Comments: SNP associated with elevated HbF and as such, a milder disease phenotype in β-thalassemia patients.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 15
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: SIN3A
Specific Location: Intron 20

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Gravia A, Chondrou V, Kolliopoulou A, Kourakli A, John A, Symeonidis A, Ali BR, Sgourou A, Papachatzopoulou A, Katsila T, Patrinos GP, Correlation of SIN3A genomic variants with β-hemoglobinopathies disease severity and hydroxyurea treatment efficacy., Pharmacogenomics , 2016 PubMed
Created on 2017-02-06 15:42:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.