IthaID: 3161



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs11036475 HGVS Name: NG_000007.3:g.43606C>T

Context nucleotide sequence:
AACGAATAACAAAAATAGGGGAAAG [A/G] TGAAAGTTCTTTCTACCGAAATCTA (Strand: +)

Comments: SNP associated with HbF levels in β-thalassaemia patients from Guangxi, Southern China (493 patients, 500 controls).

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 43606
Size: 1 bp
Located at:
Specific Location: Intron 2

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016 PubMed
Created on 2017-01-31 10:32:54, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.