IthaID: 3148



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-3 (+21bp) HGVS Name: HBA1:c.283_300+3dup
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TCAACTTCAAGGTG [-/GACCCGGTCAACTTCAAGGTG ] AGCGGCGGGCCGG (Strand: +)

Also known as:

Comments: The heterozygous form of the insertion produces small amount of unstable haemoglobin (Hb) with no specific effect on Hb level and RBC indices, but double heterozygote with other trait presenting mutations can increase unstable Hb production in a manner that presents with severe anemia.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37979
Size: 21 bp
Located at: α1
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Zekavat OR, Dehghani SJ, Imanifard J, Dehbozorgian J, Zareifar S, Haghpanah S, Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype., Hematology , 2016 PubMed
Created on 2017-01-24 11:55:48, Last reviewed on 2021-05-26 09:01:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.