IthaID: 3145
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs1984112 | HGVS Name: | NG_008192.1:g.16417A>G |
Context nucleotide sequence:
TTTACTGAACAGGAAACTGTAGTTA [A/G] GAAGTAAAAATCACAGTGAAAAATT (Strand: +)
Also known as:
Comments: SNP (G allele) associated with a higher level of reticulocyte count in Portuguese (Sub-Saharan African ancestry) and Tunisian children with sickle cell disease (SCD). It showed weak association with vaso-occlusive crisis in the Tunisian SCD cohort.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Vaso-occlusive crisis Reticulocytosis [HP:0001923] |
Location
Chromosome: | 7 |
---|---|
Locus: | NG_008192.1 |
Locus Location: | 16417 |
Size: | 1 bp |
Located at: | CD36 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Tunisian, Sub-Saharan African |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Coelho A, Dias A, Morais A, Nunes B, Ferreira E, Picanço I, Faustino P, Lavinha J, Genetic variation in CD36, HBA, NOS3 and VCAM1 is associated with chronic haemolysis level in sickle cell anaemia: a longitudinal study., Eur. J. Haematol. , 92(3), 237-43, 2014 PubMed
- Kalai M, Dridi M, Chaouch L, Moumni I, Ouragini H, Darragi I, Boudrigua I, Chaouachi D, Mellouli F, Bejaoui M, Abbes S, The role of rs1984112_G at CD36 gene in increasing reticulocyte level among sickle cell disease patients., Hematology , 2016 PubMed
Created on 2017-01-23 11:29:08,
Last reviewed on 2019-07-03 15:55:00 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-01-23 11:29:08 | The IthaGenes Curation Team | Created |
2 | 2017-01-23 11:35:17 | The IthaGenes Curation Team | Reviewed. Origin updated. |
3 | 2017-05-02 09:45:10 | The IthaGenes Curation Team | Reviewed. Mutation comment modified. Clinical phenotype added. |
4 | 2017-07-19 10:08:55 | The IthaGenes Curation Team | Reviewed. Mutation info section updated. |
5 | 2019-07-03 15:55:00 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-05-18 09:45:18