IthaID: 3134
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs762551 | HGVS Name: | NG_008431.1:g.32035C>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGCTCAAAGGGTGAGCTCTGTGGGC [A/C] CAGGACGCATGGTAGATGGAGCTTA (Strand: +)
Comments: SNP associated with variability in deferasirox plasma levels in β-thalassaemia adult patients with transfusional iron overload. Patients with AA genotype had a lower drug concentration and thus a higher risk of non-response.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Response to deferasirox |
Location
| Chromosome: | 15 |
|---|---|
| Locus: | NG_008431.2 |
| Locus Location: | 32035 |
| Size: | 1 bp |
| Located at: | CYP1A2 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Cusato J, Allegra S, Massano D, De Francia S, Piga A, D'Avolio A, Influence of single-nucleotide polymorphisms on deferasirox C trough levels and effectiveness., Pharmacogenomics J. , 15(3), 263-71, 2015 PubMed
Created on 2016-10-25 17:57:31,
Last reviewed on 2016-10-26 09:24:47 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.