IthaID: 3122
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs10421768 | HGVS Name: | NG_011563.1:g.4490A>G |
Context nucleotide sequence:
AAGGGTCTGACACTGGGAAAACACC [A/G] CGTGCGGATCGGGCACACGCTGATG (Strand: +)
Also known as:
Comments: SNP (allele A) associated with higher haemoglobin concentration in the Kenyan population [PMID: 27332551]. Variant associated with higher liver iron concentration and serum ferritin levels in poly-transfused β-thalassaemia patients of Middle Eastern descend from Italy [PMID: 19734422]. Not associated with serum iron/transferrin/ferritin levels in the healthy Galician population [PMID: 21143959].
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Increased serum ferritin [HP:0003281] Increased liver iron level [HP:0012465] Anaemia [HP:0001903] |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_011563.1 |
Locus Location: | 4490 |
Size: | 1 bp |
Located at: | HAMP |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African, Middle Eastern |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Andreani M, Radio FC, Testi M, De Bernardo C, Troiano M, Majore S, Bertucci P, Polchi P, Rosati R, Grammatico P, Association of hepcidin promoter c.-582 A>G variant and iron overload in thalassemia major., Haematologica, 94(9), 1293-6, 2009 PubMed
- Parajes S, González-Quintela A, Campos J, Quinteiro C, Domínguez F, Loidi L, Genetic study of the hepcidin gene (HAMP) promoter and functional analysis of the c.-582A > G variant., BMC Genet., 11(0), 110, 2010 PubMed
- Gichohi-Wainaina WN, Tanaka T, Towers GW, Verhoef H, Veenemans J, Talsma EF, Harryvan J, Boekschoten MV, Feskens EJ, Melse-Boonstra A, Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry., PLoS ONE , 11(6), e0157996, 2016 PubMed
Created on 2016-10-06 11:51:51,
Last reviewed on 2019-07-03 23:14:54 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-10-06 11:51:51 | The IthaGenes Curation Team | Created |
2 | 2019-07-02 14:25:08 | The IthaGenes Curation Team | Reviewed. References, Phenotype, Ethnic origin added. Comment updated. |
3 | 2019-07-02 16:36:16 | The IthaGenes Curation Team | Reviewed. Clinical phenotype added. |
4 | 2019-07-03 23:14:54 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2021-04-08 12:55:21