IthaID: 3121



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7385804 HGVS Name: NG_007989.1:g.8204G>T

Context nucleotide sequence:
CCTGAGCAGGCTGGGTGCGGTACCT [A/C] ATTCCTATAATCCCAGCATTTTGGG (Strand: +)

Also known as:

Comments: SNP (Allele C) associated with lower serum ferritin concentration in the Kenyan population.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Decreased serum ferritin [HP:0012343]

Location

Chromosome: 7
Locus: NG_007989.1
Locus Location: 8204
Size: 1 bp
Located at: TFR2
Specific Location: Intron 4

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Gichohi-Wainaina WN, Tanaka T, Towers GW, Verhoef H, Veenemans J, Talsma EF, Harryvan J, Boekschoten MV, Feskens EJ, Melse-Boonstra A, Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry., PLoS ONE , 11(6), e0157996, 2016 PubMed
Created on 2016-10-06 11:47:56, Last reviewed on 2019-07-04 12:50:48 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.