IthaID: 3085



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs200434923 HGVS Name: NG_012856.2:g.45214_45218delCCCCA

Context nucleotide sequence:
GTCCACAGCACCGTGGAGGCCATGC [-/TGGGG] TGGGGTGGGGTGGGGTGGGGTGGGG (Strand: +)

Also known as:

Comments: SNP associated with low hepcidin levels in patients with beta-thalassaemia major (n=130).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Abnormal hepcidin level [HP:0031875]

Location

Chromosome: 22
Locus: NG_012856.2
Locus Location: 45214
Size: 5 bp
Located at: TMPRSS6
Specific Location: Intron 17

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Indian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Athiyarath R, George B, Abraham A, Viswabandya A, Srivastava A, Edison ES, Genetic modifiers of secondary iron overload in beta thalassemia major., Blood Cells Mol. Dis. , 54(3), 242-3, 2015 PubMed
Created on 2016-09-12 16:24:23, Last reviewed on 2019-07-02 16:32:55 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.