IthaID: 3077

Context nucleotide sequence:
CACCCTGTGGAGCCACACCCTA [G>A] GGTTGGCCAATCTACTCCCAGG (Strand: -)

Also known as:

Comments: The -83 mutation is located several nucleotides 3’ of the CACCC box (positions -90 to -86) in the β globin gene promoter. Found in a heterozygous state together with a common heterozygous deletional α-thal mutation (-α3.7) in an adult male from Gabon presenting with mild microcytic anaemia (Hb 12.3 g/dL, MCV 76.4 fL, MCH 25.5 pg, normal Hb pattern, 3.5% Hb A2 and 0.8% Hb F) [PMID: 19657844]. Found in a heterozygous state in a Tunisian female presenting with discrete microcytic anaemia (Hb 12 g/dL, MCV 82 fL, MCH 32.2 pg, MCHC 26.4 g/100 mL, 3.7% Hb A2 and <1% Hb F) [PMID: 25754248]. Found in a compound heterozygous state with the -29 A>G β+ thal mutation [ithaID=25] in two probands who had similar indices to carriers of the -29 mutation (F/M: Hb 12.3/13.5 g/dL, MCV 68.8/75.7 fL, MCH 22.8/24.3 pg, HbA2 5.5/5.5%, HbF 2.5/2.7 %). Found in a heterozygous state in a female without abnormal indices (Hb 97.2 g/dL, MCV 86.7 fL, MCH 29.2 pg, HbA2 2.8%) and in association with CD 8 (-AA) β0 thal mutation [ithaID=61] in her premature infant having only HbF and no detectable HbA (Hb 9.8 g/dL, MCV 83.8 fL, MCH 27.1 pg, HbA2 nd%, HbF 91.2%). Found in trans with the HbS mutation in a mother (HbA 55%, HbS 38.8%) and her premature child (HbA 10.8%, HbS 9.1%), both presenting with the phenotype of Hb S trait rather than Hb S/ β+ thal. Cases are all of African or Mediterranean descent [PMID: 25405919]. Current evidence is indicative of a variant of uncertain significance.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Cadet E, Foulon K, Claisse JF, Rochette J, First identification of a point mutation at position -83 (G>A) of the beta-globin gene promoter., Hemoglobin, 33(3), 274-8, 2009 PubMed
2. Waye JS, Eng B, Hanna M, Hohenadel BA, Nakamura LN, Walker L, Non-thalassemic phenotype associated with the -83 (G > A) mutation of the β-globin gene promoter (HBB: c.-133G > A)., Hemoglobin, 38(6), 447-8, 2014 PubMed
3. Douzi K, Moumni I, Zorai A, Ben Mustapha M, Ben Mansour IM, Dorra C, Salem A, Two new β+ -thalassemia mutation [β -56 (G → C); HBBc. -106 G → C] and [β -83 (G → A); HBBc. -133 G → A] described among the Tunisian population., Am. J. Hum. Biol. , 27(5), 716-9, 2015 PubMed