IthaID: 3066

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Benign / Likely Benign
Common Name:	IVS I-108 T>C	HGVS Name:	HBB:c.93-23T>C
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GATAGGCACTGACTCTCTCTGCCTA [C>T] TGGTCTATTTTCCCACCCTTAGGCT (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP	LOVD
ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	Unclear
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70794
Size:	1 bp
Located at:	β
Specific Location:	Intron 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Cryptic splice site (mRNA Processing)
Ethnic Origin:	Iranian, European, Cuban
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Badens C, Jassim N, Martini N, Mattei JF, Elion J, Lena-Russo D, Characterization of a new polymorphism, IVS-I-108 (T-->C), and a new beta-thalassemia mutation, -27 (A-->T), discovered in the course of a prenatal diagnosis., Hemoglobin, 23(4), 339-44, 1999 PubMed
Muñiz A, Martinez G, Lavinha J, Pacheco P, Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean., Am. J. Hematol. , 64(1), 7-14, 2000 PubMed
Boussiou M, Karababa P, Sinopoulou K, Tsaftaridis P, Plata E, Loutradi-Anagnostou A, The molecular heterogeneity of beta-thalassemia in Greece., Blood Cells Mol. Dis. , 40(3), 317-9, 2008 PubMed
Vinciguerra M, Cassarà F, Cannata M, Renda D, Calvaruso G, Leto F, Passarello C, Maggio A, Giambona A, Phenotypic evaluations of HBB:c.93-23T>C, a nucleotide substitution in the IVS I nt 108 of β-globin gene., J. Clin. Pathol. , 2017 PubMed

Created on 2016-09-06 13:05:38, Last reviewed on 2022-10-21 09:45:17 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-09-06 13:05:38	The IthaGenes Curation Team	Created
2	2017-09-06 11:13:54	The IthaGenes Curation Team	Reviewed. Functionality corrected. New references added.
3	2022-10-21 09:45:17	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.