IthaID: 3057

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) HGVS Name: HBB:c.272_295dup
Hb Name: N/A Protein Info: N/A

Also known as:

Comments: Found in combination with the haemoglobin (Hb) variant Hb N-Baltimore, in cis, in two members of a family (mother and daughter), presenting with typical features of β-thal major or intermedia depending on their α-globin genotypes.

External Links


Chromosome: 11
Locus: NG_000007.3
Locus Location: 70996
Size: 24 bp
Located at: β
Specific Location: Exon 2


Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Farashi S, Rad F, Shahmohammadi B, Imanian H, Azarkeivan A, Najmabadi H, First Report of a Dominantly Inherited β-Thalassemia Caused by a Novel Elongated β-Globin Chain., Hemoglobin , 40(2), 102-7, 2016 PubMed
Created on 2016-09-02 13:20:19, Last reviewed on 2019-11-11 11:39:01 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.