IthaID: 2971
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | -44 C>A | HGVS Name: | HBA2:c.-81C>A |
Context nucleotide sequence:
AATGAGCGCCGCCCGGCCGGGCGTG [C>A] CCCCGCGCCCCAAGCATAAAC (Strand: +)
Also known as:
Comments: Found as a heterozygote. Point-mutation located at the proximal promoter region affecting the α-inverted repeat protein (α-IRP) recognition site. α-IRP is a transcriptional activator. Functional studies did not show a statistically significant change in the transcriptional activity compared to the wild type. Reported as a polymoprhic variant.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33695 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Qadah T, Finlayson J, Dennis M, Ghassemifar R, Molecular and cellular analysis of three novel alpha2-globin gene promoter mutations [HBA2: c.-59C>T], [HBA2: c.-81C>A] and [HBA2: c.-91G>A] reveal varying patterns of transcriptional and translational activities., Pathology , 46(1), 46-52, 2014 PubMed
Created on 2016-08-23 15:41:43,
Last reviewed on 2017-07-31 12:18:46 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2016-08-23 15:41:43 | The IthaGenes Curation Team | Created |
| 2 | 2017-07-31 11:00:48 | The IthaGenes Curation Team | Reviewed. Mutation description and other details modified. |
| 3 | 2017-07-31 12:18:46 | The IthaGenes Curation Team | Reviewed. Mutation description, type, and location modified. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07