IthaID: 2957



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: IVS I-117 G>A HGVS Name: HBA2:c.96-1G>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CACCCCTCACTCTGCTTCTCCCCGCA [G/A] GATGTTCCTGTCCTTCCCCACCAC (Strand: +)

Comments: This G>A replacement occurs in the acceptor splicing site which interferes with the correct RNA splicing. A gene conversion event probably explains the fact that exactly the same mutation is present on the HBA1 and HBA2 genes both. Family studies would allow to confirm it and to know if these two mutations are in cis or in trans.

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33987
Size: 1 bp
Located at: α2
Specific Location: Intron 1

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Indian
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2016-08-23 11:37:51, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.