IthaID: 2948

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs1799983	HGVS Name:	NG_011992.1:g.12965T>G

Context nucleotide sequence:
CCCTGCTGCTGCAGGCCCCAGATGA [G/T] CCCCCAGAACTCTTCCTTCTGCCCC (Strand: +)

Also known as: G894T

Comments: SNP associated with age onset of menarche in females with sickle cell disease from India (39 cases; 48 controls) [PMID: 23795274]. SNP (T allele) associated with higher hematocrit and haemoglobin levels in Greek patients with severe clinical course of SCD [PMID: 27871907]. SNP (GG genotype) associated with an increased reticulocyte count and high serum lactate dehydrogenase levels in pediatric SCA patients from Portugal [PMID: 27802215].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Delayed menarche [HP:0012569] Abnormal haematocrit [HP:0031850] Increased lactate dehydrogenase activity [HP:0025435] Reticulocytosis [HP:0001923] Anaemia [HP:0001903]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	7
Locus:	NG_011992.1
Locus Location:	12965
Size:	1 bp
Located at:	NOS3
Specific Location:	Exon 8

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Missense codons (Protein Structure)
Ethnic Origin:	Indian, Greek, Portuguese
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Nishank SS, Endothelial Nitric Oxide Synthase (eNOS) Gene Polymorphism is Associated with Age Onset of Menarche in Sickle Cell Disease Females of India., Mediterr J Hematol Infect Dis , 5(1), e2013036, 2013 PubMed
Aguiar L, Matos A, Gil Â, Afonso C, Braga L, João L, Kjollerstrom P, Faustino P, Bicho M, Inácio Â, Sickle cell anemia - Nitric oxide related genetic modifiers of hematological and biochemical parameters., Clin. Hemorheol. Microcirc. , 2016 PubMed
Armenis I, Kalotychou V, Tzanetea R, Kollia P, Kontogeorgiou Z, Anastasopoulou D, Mantzourani M, Samarkos M, Pantos K, Konstantopoulos K, Rombos I, Prognostic value of T786C and G894T eNOS polymorphisms in sickle cell disease., Nitric Oxide , 62(0), 17-23, 2017 PubMed

Created on 2016-08-09 14:34:02, Last reviewed on 2019-12-23 11:21:31 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-08-09 14:34:02	The IthaGenes Curation Team	Created
2	2016-08-16 11:49:24	The IthaGenes Curation Team	Reviewed.
3	2016-09-12 15:17:31	The IthaGenes Curation Team	Reviewed. Comment updated. Clinical phenotype added.
4	2017-01-23 13:41:44	The IthaGenes Curation Team	Reviewed. Mutation comment, clinical phenotype and other details sections updated. Reference added.
5	2017-01-30 16:14:58	The IthaGenes Curation Team	Reviewed. Clinical phenotype added.
6	2017-01-31 12:36:17	The IthaGenes Curation Team	Reviewed. Mutation comment, Clinical Phenotype and Other Info sections updated. Reference added.
7	2017-01-31 12:37:25	The IthaGenes Curation Team	Reviewed. Clinical Phenotype added.
8	2019-07-03 15:57:28	The IthaGenes Curation Team	Reviewed. Phenotype added.
9	2019-12-23 11:21:31	The IthaGenes Curation Team	Reviewed. Clinical phenotype added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.