IthaID: 2945



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs368698783 HGVS Name: NG_000007.3:g.47783G>A

Context nucleotide sequence:
GTCTGGACTAGGAGCTTATTGATAA [C/T] CTCAGACGTTCCAGAAGCGAGTGTG (Strand: +)

Also known as: Aγ(+25 G>A)

Comments: The SNP (A allele) was associated with elevated HbF in β-thalassaemia patients from Egypt, Iraq, Iran and China. It is located in the 5'UTR sequence (+25) of the Aγ-globin gene, in a region that belongs to the binding site (5'-GGTTAT-3') of LYAR (human homologue of mouse Ly-1 antibody reactive clone), a putative repressor of γ-globin gene expression. Different studies have shown that the in β-thalassemia the Gγ-globin-XmnI(+)/Aγ-globin-(G>A) genotype is under genetic linkage with the β0-thalassemia mutations.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47783
Size: 1 bp
Located at:
Specific Location: 5'UTR

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Egyptian, Iraqi, Iranian, Chinese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bianchi N, Cosenza LC, Lampronti I, Finotti A, Breveglieri G, Zuccato C, Fabbri E, Marzaro G, Chilin A, De Angelis G, Borgatti M, Gallucci C, Alfieri C, Ribersani M, Isgrò A, Marziali M, Gaziev J, Morrone A, Sodani P, Lucarelli G, Gambari R, Paciaroni K, Structural and Functional Insights on an Uncharacterized Aγ-Globin-Gene Polymorphism Present in Four β0-Thalassemia Families with High Fetal Hemoglobin Levels., Mol Diagn Ther , 20(2), 161-73, 2016 PubMed
  2. Chen D, Zuo Y, Zhang X, Ye Y, Bao X, Huang H, Tepakhan W, Wang L, Ju J, Chen G, Zheng M, Liu D, Huang S, Zong L, Li C, Chen Y, Zheng C, Shi L, Zhao Q, Wu Q, Fucharoen S, Zhao C, Xu X, A Genetic Variant Ameliorates β-Thalassemia Severity by Epigenetic-Mediated Elevation of Human Fetal Hemoglobin Expression., Am. J. Hum. Genet. , 101(1), 130-138, 2017 PubMed
  3. Breveglieri G, Bianchi N, Cosenza LC, Gamberini MR, Chiavilli F, Zuccato C, Montagner G, Borgatti M, Lampronti I, Finotti A, Gambari R, An Aγ-globin G->A gene polymorphism associated with β(0)39 thalassemia globin gene and high fetal hemoglobin production., BMC Med. Genet. , 18(1), 93, 2017 PubMed
Created on 2016-08-09 14:14:05, Last reviewed on 2017-11-13 18:38:02 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.