IthaID: 2923
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1800795 | HGVS Name: | NG_011640.1:g.4880C>G |
Context nucleotide sequence:
ACTTTTCCCCCTAGTTGTGTCTTGC [C/G] ATGCTAAAGGACGTCACATTGCACA (Strand: +)
Also known as: -174G>C
Comments: The -174G>C polymorphism associated with leg ulcers in sickle cell anaemia (SCA) patients from Brazil [PMID: 25595815]. SNP (G allele) associated with a lower risk of stroke in SCA patients from Brazil [PMID: 28542795].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Leg ulcers [OMIM:150590] Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 7 |
|---|---|
| Locus: | NG_011640.1 |
| Locus Location: | 4880 |
| Size: | 1 bp |
| Located at: | IL6 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Vicari P, Adegoke SA, Mazzotti DR, Cançado RD, Nogutti MA, Figueiredo MS, Interleukin-1β and interleukin-6 gene polymorphisms are associated with manifestations of sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 244-9, 2015 PubMed
- Domingos IF, Pereira-Martins DA, Coelho-Silva JL, Borges-Medeiros RL, Falcão DA, Azevedo RC, Anjos AC, Costa FF, Mendonça TF, Cavalcanti MS, Araujo AS, Lucena-Araujo AR, Bezerra MA, Interleukin-6 G-174C polymorphism predicts higher risk of stroke in sickle cell anaemia., Br. J. Haematol. , 2017 PubMed
Created on 2016-05-26 12:07:14,
Last reviewed on 2017-07-19 10:54:56 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2016-05-26 12:07:14 | The IthaGenes Curation Team | Created |
| 2 | 2016-08-17 12:29:13 | The IthaGenes Curation Team | Reviewed. Synonym name added. |
| 3 | 2017-07-19 10:54:56 | The IthaGenes Curation Team | Reviewed. Mutation info, type and location sections updated. Clinical phenotype added. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07