IthaID: 2920



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs17599586 HGVS Name: NG_007086.2:g.15355C>T

Context nucleotide sequence:
TCCTTGACCTGAAACCAAGTCCCAG [C/T] TGACACTTTCAGAATGTCCATCAGT (Strand: +)

Comments: SNP associated with variation in HbF levels in pediatric patients with sickle cell disease receiving hydroxyurea treatment, who were recruited from the Hydroxyurea Study of Long-Term Effects (HUSTLE; n=174).

External Links

Location

Chromosome: 6
Locus: NG_007086.2
Locus Location: 15355
Size: 1 bp
Located at: ARG1
Specific Location: Intron 7

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Ware RE, Despotovic JM, Mortier NA, Flanagan JM, He J, Smeltzer MP, Kimble AC, Aygun B, Wu S, Howard T, Sparreboom A, Pharmacokinetics, pharmacodynamics, and pharmacogenetics of hydroxyurea treatment for children with sickle cell anemia., Blood , 118(18), 4985-91, 2011 PubMed
  2. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014 PubMed
Created on 2016-05-25 16:12:22, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.