IthaID: 2915

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: -840 G>A HGVS Name: NC_000004.12:g.69095621G>A

Context nucleotide sequence:
ccaaataactgtgaggaagtgagtc [A/G ] gagaacaagctaacctaatgattaa (Strand: +)

Also known as: rs7438135

Comments: The presence of the UGT2B7 -840G allele associated with reduced morphine glucuronidation in sickle cell disease (SCD) patients, thereby contributing to the variability in hepatic clearance of morphine in SCD.

External Links


Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Morphine glucuronidation


Chromosome: 4
Locus Location: N/A
Size: 1 bp
Located at: UGT2B7
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Darbari DS, van Schaik RH, Capparelli EV, Rana S, McCarter R, van den Anker J, UGT2B7 promoter variant -840G>A contributes to the variability in hepatic clearance of morphine in patients with sickle cell disease., Am. J. Hematol. , 83(3), 200-2, 2008 PubMed
Created on 2016-05-24 12:06:44, Last reviewed on 2019-07-03 21:46:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.