IthaID: 2915
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -840 G>A | HGVS Name: | NC_000004.12:g.69095621G>A |
Context nucleotide sequence:
ccaaataactgtgaggaagtgagtc [A/G ] gagaacaagctaacctaatgattaa (Strand: +)
Also known as: rs7438135
Comments: The presence of the UGT2B7 -840G allele associated with reduced morphine glucuronidation in sickle cell disease (SCD) patients, thereby contributing to the variability in hepatic clearance of morphine in SCD.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Morphine glucuronidation |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Darbari DS, van Schaik RH, Capparelli EV, Rana S, McCarter R, van den Anker J, UGT2B7 promoter variant -840G>A contributes to the variability in hepatic clearance of morphine in patients with sickle cell disease., Am. J. Hematol. , 83(3), 200-2, 2008 PubMed
Created on 2016-05-24 12:06:44,
Last reviewed on 2019-07-03 21:46:21 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2016-05-24 12:06:44 | The IthaGenes Curation Team | Created |
| 2 | 2019-07-03 21:46:21 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07