IthaID: 2910



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: BsmI polymorphism HGVS Name: NG_008731.1:g.63980G>A

Context nucleotide sequence:
TTCCTGGGGCCACAGACAGGCCTGC [A/G] CATTCCCAATACTCAGGCTCTGCTC (Strand: -)

Also known as: rs1544410

Comments: SNP associated with bone mineral density in individuals with β-thalassaemia (n=42).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Osteoporosis [HP:0000939] [OMIM:166710]

Location

Chromosome: 12
Locus: NG_008731.1
Locus Location: 63980
Size: 1 bp
Located at: VDR
Specific Location: Intron 9

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. El-Edel RH, Ghonaim MM, Abo-Salem OM, El-Nemr FM, Bone mineral density and vitamin D receptor polymorphism in beta-thalassemia major., Pak J Pharm Sci , 23(1), 89-96, 2010 PubMed
Created on 2016-05-23 17:03:17, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.