IthaID: 29



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: -28 (A>G) HGVS Name: HBB:c.-78A>G
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AGGGCAGGAGCCAGGGCTGGGCATA [A/C/G] AAGTCAGGGCAGAGCCATCTATTGC (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70517
Size: 1 bp
Located at: β
Specific Location: Promoter 0

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African-American, Southeast Asians
Inheritance: Recessive
DNA Sequence Determined: No
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Orkin SH, Sexton JP, Cheng TC, Goff SC, Giardina PJ, Lee JI, Kazazian HH, ATA box transcription mutation in beta-thalassemia., Nucleic acids research, 11(14), 4727-34, 1983 PubMed
  2. Antonarakis SE, Irkin SH, Cheng TC, Scott AF, Sexton JP, Trusko SP, Charache S, Kazazian HH, beta-Thalassemia in American Blacks: novel mutations in the "TATA" box and an acceptor splice site., Proceedings of the National Academy of Sciences of the United States of America, 81(4), 1154-8, 1984 PubMed
  3. Huang S, Wong C, Antonarakis SE, Ro-lien T, Lo WH, Kazazian HH, The same "TATA" box beta-thalassemia mutation in Chinese and US blacks: another example of independent origins of mutation., Human genetics, 74(2), 162-4, 1986 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.