IthaID: 29



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: -28 (A>G) HGVS Name: HBB:c.-78A>G
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AGGGCAGGAGCCAGGGCTGGGCATA [A/C/G] AAGTCAGGGCAGAGCCATCTATTGC (Strand: -)

Also known as:

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70517
Size: 1 bp
Located at: β
Specific Location: Promoter

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African-American, Southeast Asians
Inheritance: Recessive
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Orkin SH, Sexton JP, Cheng TC, Goff SC, Giardina PJ, Lee JI, Kazazian HH, ATA box transcription mutation in beta-thalassemia., Nucleic acids research, 11(14), 4727-34, 1983 PubMed
  2. Lou JW, Li Q, Wei XF, Huang JW, Xu XM, Identification of the linkage of a 1.357 KB beta-globin gene deletion and A gamma-globin gene triplication in a Chinese family., Hemoglobin, 34(4), 343-53, 2010 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2020-01-17 11:11:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.