IthaID: 2894



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs5742911 HGVS Name: NG_009060.1:g.48389A>G

Context nucleotide sequence:
ACCATGCATGGTGCATCAGCAGCCC [A/G] TGGCCTCTGGCCAGGCATGGCGAGG (Strand: +)

Also known as:

Comments: SNP associated with protection from stroke (small vessel subtype) in the Cooperative Study of Sickle Cell Disease (CSSCD; n=230).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 19
Locus: NG_009060.1
Locus Location: 48389
Size: 1 bp
Located at: LDLR
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Hoppe C, Klitz W, Cheng S, Apple R, Steiner L, Robles L, Girard T, Vichinsky E, Styles L, , Gene interactions and stroke risk in children with sickle cell anemia., Blood , 103(6), 2391-6, 2004 PubMed
  2. Driss A, Asare KO, Hibbert JM, Gee BE, Adamkiewicz TV, Stiles JK, Sickle Cell Disease in the Post Genomic Era: A Monogenic Disease with a Polygenic Phenotype., Genomics Insights , 2009(2), 23-48, 2009 PubMed
Created on 2016-05-23 09:37:22, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.