IthaID: 2853
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs7586110 | HGVS Name: | NG_002601.2:g.97138T>G |
Context nucleotide sequence:
CAGGTTCTATCTGTACTTCTTCCAC [G/T] TACTATATTATAGGAGCTTAGAATC (Strand: +)
Also known as:
Comments: SNP associated with variation in bilirubin levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1117). The association was replicated in four independent studies, namely, the Multicenter Study of Hydroxyurea (MSH; n=195), the Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy (Walk-PHaSST; n=522), the Outcome Modifying Genes study (n=530) and the SITT silent cerebral infarct trial (n=905). This SNP overlaps the UGT1A8, UGT1A9 and UGT1A10 genes within the UGT1A locus.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Bilirubin levels |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_002601.2 |
Locus Location: | 97138 |
Size: | 1 bp |
Located at: | UGT1A10 |
Specific Location: | Intron |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Milton JN, Sebastiani P, Solovieff N, Hartley SW, Bhatnagar P, Arking DE, Dworkis DA, Casella JF, Barron-Casella E, Bean CJ, Hooper WC, DeBaun MR, Garrett ME, Soldano K, Telen MJ, Ashley-Koch A, Gladwin MT, Baldwin CT, Steinberg MH, Klings ES, A genome-wide association study of total bilirubin and cholelithiasis risk in sickle cell anemia., PLoS ONE , 7(4), e34741, 2012 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-18 14:23:04 | The IthaGenes Curation Team | Created |
2 | 2016-05-18 14:36:01 | The IthaGenes Curation Team | Reviewed. |