IthaID: 2842



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs9494145 HGVS Name: NC_000006.12:g.135111414T>C

Context nucleotide sequence:
ATACTCTAAAAGCCCCTCCATACCA [C/T] CCCTAATACTTTAAAAGCCGCTAGA (Strand: +)

Comments: SNP associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=848), as well as in a replication study, which enrolled subjects from the Multicenter Study of Hydroxyurea (MSH; n=212), the Duke University pulmonary hypertension study (n=78), and the Boston Medical Center (BMC) pulmonary hypertension study (n=15). SNP associated with HbF levels in individuals from Tanzania with sickle cell disease (n=1022 individuals), and in individuals with β-thalassaemia from Guangxi, Southern China (n=493). It associated with disease severity and HbF levels in Thai β0-thalassaemia/HbE patients.

External Links

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tanzanian, African American, Thai, Chinese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Solovieff N, Milton JN, Hartley SW, Sherva R, Sebastiani P, Dworkis DA, Klings ES, Farrer LA, Garrett ME, Ashley-Koch A, Telen MJ, Fucharoen S, Ha SY, Li CK, Chui DH, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5' olfactory receptor gene cluster., Blood , 115(9), 1815-22, 2010 PubMed
  2. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
  3. Mtatiro SN, Singh T, Rooks H, Mgaya J, Mariki H, Soka D, Mmbando B, Msaki E, Kolder I, Thein SL, Menzel S, Cox SE, Makani J, Barrett JC, Genome wide association study of fetal hemoglobin in sickle cell anemia in Tanzania., PLoS ONE , 9(11), e111464, 2014 PubMed
  4. Mtatiro SN, Mgaya J, Singh T, Mariki H, Rooks H, Soka D, Mmbando B, Thein SL, Barrett JC, Makani J, Cox SE, Menzel S, Genetic association of fetal-hemoglobin levels in individuals with sickle cell disease in Tanzania maps to conserved regulatory elements within the MYB core enhancer., BMC Med. Genet. , 16(0), 4, 2015 PubMed
  5. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016 PubMed
Created on 2016-05-17 15:12:27, Last reviewed on 2018-11-20 19:32:10 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.