IthaID: 2840



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs66650371 HGVS Name: NC_000006.12:g.135097495_135097497delTAC

Context nucleotide sequence:
TAAATTCACTCTGGACAGCAGATGT [-/TAC] TATATCAAAACCACAAAATGTTATC (Strand: +)

Comments: rs66650371 is a 3-bp (TAC) deletion polymorphism located within an enhancer-like element 84 kb upstream of the MYB transcriptional start site (-84 LDB1 complex/KLF1-binding site). The rs66650371-deleted -84 allele negatively affects enhancer function and MYB regulation [PMID: 24614105]. Investigating a 50-bp RNA transcript adjacent to this variant, gave rise to a novel 1283 bp lncRNA with an important role in silencing γ-globin gene expression in adults [PMID: 29227829]. The 3-bp deleted allele of rs66650371 had a significant effect on the red blood cell, white blood cell and platelet counts, and strongly associated with elevated HbF and Hb levels in sickle cell disease cohorts from Tanzania [PMID: 25928412, 25263325] and Nigeria [PMID: 29879141]. It also associated with elevated HbF levels in β-thalassaemia patients and/or carriers from China and Hong Kong [PMID: 27835778, 21385855].

External Links

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 3 bp
Located at: HBS1L-MYB
Specific Location: N/A 0

Phenotype

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tanzanian, Chinese, Nigerian
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011 PubMed
  2. Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014 PubMed
  3. Mtatiro SN, Mgaya J, Singh T, Mariki H, Rooks H, Soka D, Mmbando B, Thein SL, Barrett JC, Makani J, Cox SE, Menzel S, Genetic association of fetal-hemoglobin levels in individuals with sickle cell disease in Tanzania maps to conserved regulatory elements within the MYB core enhancer., BMC Med. Genet. , 16(0), 4, 2015 PubMed
  4. Mtatiro SN, Makani J, Mmbando B, Thein SL, Menzel S, Cox SE, Genetic variants at HbF-modifier loci moderate anemia and leukocytosis in sickle cell disease in Tanzania., Am. J. Hematol., 90(1), E1-4, 2015 PubMed
  5. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016 PubMed
  6. Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018 PubMed
  7. Morrison TA, Wilcox I, Luo HY, Farrell JJ, Kurita R, Nakamura Y, Murphy GJ, Cui S, Steinberg MH, Chui DHK, A long noncoding RNA from the HBS1L-MYB intergenic region on chr6q23 regulates human fetal hemoglobin expression., Blood Cells Mol. Dis., 69(0), 1-9, 2018 PubMed
Created on 2016-05-17 15:03:26, Last reviewed on 2019-07-02 14:45:50 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.