IthaID: 2840



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs66650371 HGVS Name: NC_000006.12:g.135097495_135097497delTAC

Context nucleotide sequence:
TAAATTCACTCTGGACAGCAGATGT [-/TAC] TATATCAAAACCACAAAATGTTATC (Strand: +)

Comments: This is a 3-bp deletion polymorphism located in the enhancer region of the MYB gene, which has an important role in silencing γ-globin expression in adults. Specifically, this SNP associated with HbF levels in individuals from Tanzania with sickle cell disease (SCD; n=1022) and in β-thalassaemia patients from Guangxi, Southern China (n=493). SNP associated with increased HbF, haemoglobin levels, and red blood cell count, as well as with lower platelet counts in Nigerian patients with SCD (n=260).

External Links

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 3 bp
Located at: HBS1L-MYB
Specific Location: N/A 0

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Platelet count [HP:0011873]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tanzanian, Chinese, Nigerian
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Mtatiro SN, Mgaya J, Singh T, Mariki H, Rooks H, Soka D, Mmbando B, Thein SL, Barrett JC, Makani J, Cox SE, Menzel S, Genetic association of fetal-hemoglobin levels in individuals with sickle cell disease in Tanzania maps to conserved regulatory elements within the MYB core enhancer., BMC Med. Genet. , 16(0), 4, 2015 PubMed
  2. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016 PubMed
  3. Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018 PubMed
  4. Morrison TA, Wilcox I, Luo HY, Farrell JJ, Kurita R, Nakamura Y, Murphy GJ, Cui S, Steinberg MH, Chui DHK, A long noncoding RNA from the HBS1L-MYB intergenic region on chr6q23 regulates human fetal hemoglobin expression., Blood Cells Mol. Dis., 69(0), 1-9, 2018 PubMed
Created on 2016-05-17 15:03:26, Last reviewed on 2018-11-20 19:28:40 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.