IthaID: 2821

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs10195871	HGVS Name:	NG_011968.1:g.65045T>C

Context nucleotide sequence:
CCTGGAGAGTTCAACTCCAAACCCT [A/G] TATCCCAGCTATCTGTTTGGCTCAG (Strand: +)

Also known as:

Comments: SNP associated with elevated HbF in African Americans with sickle cell disease (SCD), recruited from the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study, and the Thomas Jefferson University. The association was replicated in an independent patient sample acquired from the CSSCD study. Also, the G allele associated with HbF in Kuwaiti patients with SCD. The SNP was found in strong LD (X2 = 0.9) with rs10172646 and in moderate LD (X2 = 0.6) with rs11886868. [PMID: 34204365].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Hb F levels [HP:0011904] [OMIM:141749]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	2
Locus:	NG_011968.1
Locus Location:	65045
Size:	1 bp
Located at:	BCL11A
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American, Kuwaiti
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021 PubMed

Created on 2016-05-17 11:42:48, Last reviewed on 2021-09-23 15:56:19 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-17 11:42:48	The IthaGenes Curation Team	Created
2	2021-09-23 15:55:04	The IthaGenes Curation Team	Reviewed. Reference and Ethnic origin added. Comment updated.
3	2021-09-23 15:56:19	The IthaGenes Curation Team	Reviewed. Text edits.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.