IthaID: 2806



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs3759074 HGVS Name: NG_000007.3:g.61068C>T

Context nucleotide sequence:
GTATTCTTTCTGAGCTCCAGATCCA [C/T] ATATCTAAGTACATCTTTTTGCATT (Strand: -)

Comments: SNP associated with HbF levels in patients from Thailand with HbE/β0-thalassemia, who were classified as clinically mild for the disease (n=207).

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 61068
Size: 1 bp
Located at: δ
Specific Location: N/A

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010 PubMed
Created on 2016-05-16 18:51:33, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.