IthaID: 280
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS I [3' end] (-25 bp) | HGVS Name: | NC_000011.10(NM_000518.4):c.93-22_95del |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CACTGACTCTCTCTGCCTAT [TGGTCTATTTTCCCACCCTTAGGCT/-] GCTGGTGGTCTACCCTTGGA (Strand: -)
Also known as: 25 bp deletion
Comments: The original publication regarding this 25 bp deletion [PMID: 6190800] describes two possible deletion ranges due to the presence of a T at both the 5' and 3' boundaries. In accordance with the HGVS 3' rule, this variant can be designated as NC_000011.10:g.5226798_5226822del and for the affected transcript as NC_000011.10(NM_000518.4):c.93-22_95del. An updated case was reported in a 20-year-old female with severe microcytosis and hypochromia and increased Hb A2 level.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70795 |
| Size: | 25 bp |
| Located at: | β |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Middle East |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Orkin SH, Sexton JP, Goff SC, Kazazian HH, Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia., The Journal of biological chemistry, 258(12), 7249-51, 1983 PubMed
- Hassan SM, Vossen RH, Chessa R, den Dunnen JT, Bakker E, Giordano PC, Harteveld CL, Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology., Blood Cells Mol Dis, 53(3), 133-7, 2014 PubMed
- Adekile AD, Azab AF, Al-Sharida SI, Al-Nafisi BA, Akbulut N, Marouf RA, Mustafa NY, Clinical and Molecular Characteristics of Non-Transfusion-Dependent Thalassemia in Kuwait., Hemoglobin , 39(5), 320-6, 2015 PubMed
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Feleki, Xenia | 2022-09-23 | Report of an update. |
Created on 2010-06-16 16:13:15,
Last reviewed on 2024-10-08 13:09:20 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-31 18:11:44 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2021-02-01 09:12:18 | The IthaGenes Curation Team | Reviewed. HGVS name, Chromosome and Locus locations corrected. |
| 4 | 2021-02-01 09:14:15 | The IthaGenes Curation Team | Reviewed. Gene added. |
| 5 | 2021-02-08 09:04:29 | The IthaGenes Curation Team | Reviewed. Specific location added. |
| 6 | 2022-09-23 10:46:49 | The IthaGenes Curation Team | Reviewed. Comment and contributor added. |
| 7 | 2024-10-08 13:09:20 | The IthaGenes Curation Team | Reviewed. HGVS name corrected, Comment updated, References added |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07