IthaID: 28



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -28 (A>C) HGVS Name: HBB:c.-78A>C
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGGGCAGGAGCCAGGGCTGGGCATA [A/C] AAGTCAGGGCAGAGCCATCTATTGC (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70517
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Kurdish, Spanish
Molecular mechanism: TATAA box (HBB)
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Poncz M, Ballantine M, Solowiejczyk D, Barak I, Schwartz E, Surrey S, beta-Thalassemia in a Kurdish Jew. Single base changes in the T-A-T-A box., The Journal of biological chemistry, 257(11), 5994-6, 1982 PubMed
  2. Gamarra S, Garcia-Effron G, Monteserin C, Lopez-Villar I, Gilsanz F, Martinez-Lopez J, beta-Thalassaemia Major in a Spanish Patient due to a Compound Heterozygosity for CD39 C --> T/-28 A --> C., Adv Hematol, 2009(0), 476342, 2009 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2022-06-10 12:52:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.