IthaID: 2792



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs4910742 HGVS Name: NG_000007.3:g.12337C>T

Context nucleotide sequence:
TCAACAAATAGTAGTAGATTTTATC [A/G] TCCATTAATCCTTCCCTCTCCTCTC (Strand: +)

Also known as:

Comments: SNP strongly associated with elevated HbF and other haematological indices (e.g., HbA2 and Hb levels, red blood cell counts, MCV, MCH and MCHC) in the general (non-anaemic) population of Sardinia (n=4305 in the initial screen and n=521 in the replication study).

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 12337
Size: 1 bp
Located at: βLCR
Specific Location: N/A 0

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Abnormal red blood cell count [HP:0020058]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Sardinian
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008 PubMed
Created on 2016-05-16 17:24:13, Last reviewed on 2019-12-23 14:38:13 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.