IthaID: 2787



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4808793 HGVS Name: NC_000019.10:g.18383027G>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACATGCAGACACCCACACACACCCA [C/G] TATCTGCCGGACAGGGCAGCCCTTC (Strand: +)

Comments: SNP associated with increased GDF15 levels, which had a suppressive effect on serum hepcidin levels in β-thalassaemia patients from India (n=134).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Abnormal hepcidin level [HP:0031875]

Location

Chromosome: 19
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: GDF15
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Indian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Athiyarath R, George B, Mathews V, Srivastava A, Edison ES, Association of growth differentiation factor 15 (GDF15) polymorphisms with serum GDF15 and ferritin levels in β-thalassemia., Ann. Hematol. , 93(12), 2093-5, 2014 PubMed
Created on 2016-05-16 15:18:15, Last reviewed on 2016-09-12 12:48:52 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.