IthaID: 2786



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4803221 HGVS Name: NG_042193.1:g.1483G>C

Context nucleotide sequence:
TCCGGGGCTCCAGCGAGCGGTAGTG [C/G] GAGAGCAGGCAGCGCCGGGGGGCCG (Strand: +)

Also known as:

Comments: SNP associated with viral clearance prediction in β-thalassaemia patients recruited from two Italian major centers in Cagliari and Torino (368 cases; 215 controls).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Response to Hepatitis C treatment

Location

Chromosome: 19
Locus: NG_042193.1
Locus Location: 1483
Size: 1 bp
Located at: IFNL3
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Origa R, Marceddu G, Danjou F, Perseu L, Satta S, Demartis FR, Piga A, Longo F, Lai ME, Vacquer S, Galanello R, IFNL3 polymorphisms and HCV infection in patients with beta thalassemia., Ann Hepatol , 14(3), 389-95, 2015 PubMed
Created on 2016-05-16 15:11:15, Last reviewed on 2019-07-03 22:18:09 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.