IthaID: 2784



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs55659002 HGVS Name: NG_013364.1:g.16889delC

Context nucleotide sequence:
GGCGGCCGGTAGTGAACCCTGCTTT [-/G] GTGTGGGAGTCAGGGGATAGGGGAC (Strand: +)

Also known as: 713-8delC

Comments: SNP associated with low bone mineral density in patients with β-thalassemia major acquired from the SGPGIMS medical institute in India (n=150) [PMID: 23790953]. The association was not replicated in an independent study, which recruited patients with β-thalassemia major from Italy (n=135) [PMID: 11122085].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Osteoporosis [HP:0000939] [OMIM:166710]

Location

Chromosome: 19
Locus: NG_013364.1
Locus Location: 16889
Size: 1 bp
Located at: TGFB1
Specific Location: Intron 4

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: North Indian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Perrotta S, Cappellini MD, Bertoldo F, Servedio V, Iolascon G, D'Agruma L, Gasparini P, Siciliani MC, Iolascon A, Osteoporosis in beta-thalassaemia major patients: analysis of the genetic background., Br. J. Haematol. , 111(2), 461-6, 2000 PubMed
  2. Singh K, Agarwal S, Shukla A, Gupta S, A sequence variation: 713-8delC in the transforming growth factor beta 1 gene polymorphism in thalassemia major patients., J Clin Densitom , 17(1), 185-9, 2014 PubMed
Created on 2016-05-16 15:01:34, Last reviewed on 2016-05-16 15:04:15 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.