IthaID: 2782



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7203560 HGVS Name: NG_029669.1:g.9308A>C

Context nucleotide sequence:
AAATTTAAAAACCTAGTGATGAATC [G/T] AAGAAGAGTGCAAAAGGCCCATGAA (Strand: +)

Also known as:

Comments: SNP associated with haemolytic anaemia in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1117), the Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy (Walk-PHaSST) study (n=449), as well as in a cohort of SCA patients from London, UK (n=213). The haemolytic score was derived from reticulocyte count, serum bilirubin, lactate dehydrogenase (LDH), and aspartate transaminase (AST) levels. SNP significantly associated with a lower level of each of the four haemolytic markers in the CSSCD study.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Bilirubin levels
Reticulocytopenia [HP:0001896]

Location

Chromosome: 16
Locus: NG_029669.1
Locus Location: 9308
Size: 1 bp
Located at: NPRL3
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Milton JN, Rooks H, Drasar E, McCabe EL, Baldwin CT, Melista E, Gordeuk VR, Nouraie M, Kato GR, Kato GJ, Minniti C, Taylor J, Campbell A, Luchtman-Jones L, Rana S, Castro O, Zhang Y, Thein SL, Sebastiani P, Gladwin MT, , Steinberg MH, Genetic determinants of haemolysis in sickle cell anaemia., Br. J. Haematol. , 161(2), 270-8, 2013 PubMed
Created on 2016-05-16 14:48:23, Last reviewed on 2019-12-23 12:36:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.